Gaps in Evolution?

[mattj]

you're not worth the time

 

[Profesco]

Guys, this thread seems to be on its last legs. Should we give it more time to correct itself? Evolutionary theory is always worth discussing, in part so we can compare theories on the unclear portions and in part so we can clear up misconceptions about the theory in general. Even little progress is scientific literacy is better than no progress, right?

You have no understanding whatsoever of either what the Bible says, or how Christians apply it.

I go to a very conservative church. However, my pastor is a Geologist for the Missouri Department of Natural Resources. He accepts the old age of the Earth, and is open to the idea of evolution, although he accepts the Bible's account of creation on face value. Our worship leader fully accepts our current understanding of the theory of evolution as fact, and believes it was God's method of creation. You are an idiot if you believe that Christians cannot accept evolution and still hold firm to the words of the Bible. Millions do it.

I have to ask, mattj, what do you mean by "face value" and "hold firm to the words of the Bible" in this paragraph? Normally, those expressions in this context would be interpreted as another way of saying "Biblical literalism." And you did say you were a Bible literalist.

But if that's correct so far, then how can someone who takes the explanations of the Bible literally or at face value also accept that the Earth is billions of years old? The Bible says it is only a few thousand years old. It also says God created the Earth and everything in it in just six days, while multiple fields of scientific observation converge on the explanation of Earth's formation as taking... well, far longer to say the least.

In making the claim that one accepts the explanations of geological science while also taking the Bible literally, then either "accepts," "Bible," or "literally" is grossly misdefined.

 

[mattj]

I understand what you're asking. I posted what I posted to show that not all "Bible Literalists" read or interpret the Bible exactly the same way, and definitely not in the insane, twisted light that Snorunt Conservationist so happily casts us.

I personally hold fast to what I believe is the common, plain reading of Genesis, believing that the Earth was infact created in seven literal days, and all the creatures in it. I, however, do not find any single scripture that ties the age of the Earth to 6000 years as is commonly purported. I also currently reject the theory of evolution based firstly on the fact that our current understanding of it does not seem compatible with my plain reading of Genesis, and because of the many problems, shortcomings, and difficulties that any honest biologist will admit are currently present. I am being honest when I say, that if those problems did not exist, I would be FORCED to go back and take a hard look at how I'm interpreting Genesis. But so far that's not the case, and because I'm so convinced that the Bible is the Word of God, I'll take it's plain reading over the current, temporary scientific consensus.

My pastor has similar views, although he personally can see how evolution and Genesis could co-incide. He still takes the common, plain reading of Creation to be an accurate account though, but could see how evolution could happen after that. We've talked about it, and I disagree, but neither of us charge the other with being anything other than a Literalist. We both look at the same words. We both read them. We both agree they're the Word of God. We both desire to apply them as literally as possible. We just disagree on some of the finer points of the reading and interpretation of Genesis.

Our worship leader John wholeheartedly believes in the old age of the Earth, and that evolution was God's method of Creation. He believes that Genesis is absolutely the Word of God, but he believes the words on the page mean something other than what Pastor and I interpret them to mean. He believes the word day is there for a specific reason, but that the definition of day in that case means something completely different. He believes it took seven days, but what is the definition of "day" in that particular verse. While I understand where he's coming from, we disagree, but we both agree we want to read, believe, and apply the Word of God as literally as we can.

Snorunt Conservationist has slandered me, and those I cherish as backwards, buck-toothed, Bible-thumping, ignorant, child abusing, homophobic, retards. He couldn't be farther from the truth. I spoke of the three of us as examples of Literalists whos acceptance of evolution vary.

I understand what evolution is. I've read Origin of Species. I've listened to the other side in these debates for a good number of years now. My Biology teacher was very good at getting the concepts across. I just disagree with it for several legitimate reasons.

My pastor understands what evolution is. He's a geologist. He's very well educated. He could accept it, but currently takes the most simple, plain reading of Genesis to be the correct one, for various legitimate reasons.

Our worship leader John is a very well educated military man. He wholeheartedly accepts evolution as being Biblical even! He has legitimate reasons for doing so.

Point #1) Bible literalists are not all the same, nor are they backwards, ignorant, or harmful.
Point #2) There are legitimate reasons to question the theory of evolution. To purport otherwise is merely inflammatory, if not uninformed.

 

[Snorunt conservationist]

Snorunt Conservationist has slandered me,

Sigh. Can't be bothered to address the other things, but this comment is somewhat ridiculous from the man who has posted a picture of Hitler alongside my words.

 

[mattj]

in response to what you said about me

 

[Abundantly]

*sigh* Okay, let's see if I can clear some stuff up.

First, I don't care to look at charts. Really. I like real information I can look into. Charts prove nothing. All they do is show how evolutionists think things evolved, and I don't even buy evolution to begin with.

Second, I must apologize. I did read your post, J.T., but apparently not all of it. I must have skipped a chunk of it somewhere along the way, I guess. All I remember is "Blah blah blah, evolution is a fact, blah blah, we don't assume, we know, blah blah yada, creationists don't ever have proof, blah yada." So, yeah, you can see why I figured it wouldn't be worth my while to respond specifically to your post when I could just go over the basic relevant information again so that people would stop trying to change the subject.

That said, allow me to explain why I still don't accept natural selection as evolution.

You started with black and white moths, right? Let's say there were more white moths to begin with because they survive better. Okay, then the trees change color. The white moths get eaten and the black ones survive to tell their grandbabymoths. So, you started with black and white moths, and ended with. . . black and white moths.

Now, if the trees turned purple, you'd run into some trouble. See, moths don't have genes for looking purple, so all the moths would die or else have to move to a new habitat.

Natural Selection, right?

Okay, now for evolution. Let's say you've actually got purple trees. Well, our moth-friends are getting eaten all the time. So one moth just randomly gives birth to a purple mothbaby. That purple mothbaby's Purple-gene manages to override the dominant black/white genes in its own mothbabies, and the mothbabies are all born purple. Except one. His name is Billy. Billy turned green.

Evolution.

Okay, see, while natural selection can cause a particular trait to spread throughout an animal group, it cannot produce such a trait. Therefore, natural selection alone cannot turn worms into chickens. It just doesn't happen.

So yes, natural selection is part of the hypothesis of evolution (just messing with you), and yes, natural selection does result in a sort of change, but no, natural selection is not enough to turn chemicals into chemists. Now, if you define "evolution" as "change," then even inanimate objects "evolve." The evolution creationists have a problem with is the one that claims that a puddle of chemicals just happened to come together in just the right way to form life, which then became every living organism on the face of the Earth. And that evolution requires the increase of genetic information.

Surely you understand that?

Okay, next, I do not have to prove that God exists right now. That is not the point of this discussion. I'm here to talk about evolution. I am a creationist, though, so for the sake of discussion, we have to compare different possibilities, including the possibility (*cough*, fact) that God did create everything. See, in this thread, our usual roles are reversed. This time, Darwin has to answer for his claim. I am questioning evolution. You are not questioning creationism. We've both made claims. I'm just challenging Darwin's claim for a change.

I'm a scientific heretic, I know. You'll get over it.

Moving on. (Real quick quote.)

A gigantic mass of flowing water wouldn't mix anything around?

Oh, don't get me wrong. It did mix things around, I'm sure. But, especially with the eruption of a supervolcano, the bottom-dwelling ocean creatures would have still fossilized at the bottom. Unlucky land creatures would have fossilized above that. Some would have fossilized above the others because of all the mixing around.

Anyway, moving on.

The age of the rocks is based on either an evolutionary standpoint or a Biblical standpoint.

Now, I'm no expert on radiometric dating, so I'll be using some information from someone who is.

Lots of things have been shown to speed up the decay rates of radioactive unstable elements. The most extreme is high-energy heating, such as in the plasma state. At that high a temperature, unstable atoms decay at even trillions of times their usual rate. This is funny, because evolutionists believe that the who universe was on in the plasma state. Our sun is too, as is every bolt of lightning. In our atmosphere.

Other effects have been noted in other changing conditions such as underground temperature, pressure, and magnetic field. In 2010, it was discovered that every 38 days in the solar cycle, Cesium atoms here on Earth decay faster – the effect is even greater during times solar flare activity. The evolutionists’ mantra of “constant decay rates” has now been proven – by science – to be nothing but an urban myth. It is not true. It cannot be offered in evidence for an Earth older than 6000 years.​

That's reason number one. Next, there's the problem of knowing the original amount of isotope. See, when evolutionists see very little of a particular isotope in a rock, they assume that the rock is very old. But couldn't there have just been very little isotope in the rock to begin with?

Evolutionists do have ways of guessing how much isotope was there to begin with, but it's still guesswork.

They try to do A-B=C, but by assuming what A is. That leads to an inaccurate C.

3. The original amount of decay product.

Not only do evolutionists run tests on how much of the "parent isotope" is left, but also on how much of the decay product is found in the sample. Unstable elements eventually turn into stable things. Like when Uranium-238 turns into Lead.

So, when they find lots of lead in a sample, evolutionist researchers tend to assume that much of the stable element (or that the whole of it) actually did come from the unstable atom decaying, and not from just being there in the rock to begin with.

The question you should be asking is "Can stable elements like that be in rocks to begin with?"

"Decay products" end up in rocks all the time without actually resulting from decay. Lead doesn't always come from Uranium-238.

4. Evolutionist researchers assume that the rock sample has remained undisturbed by anything that could have affected its decay rate or parent isotope amount or daughter isotope amount – for billions of years. Highly unlikely. In fact, it is highly likely that something did, in fact, disturb a three-billion year-old sample.

Nearby earthquakes, magma chambers getting too close, chemical changes, isotopes dissolving, ground water leaking into or out of the layer, the crystallization of incoming isotopes -- all these things could easily affect any one rock sample underground, in just a matter of centuries. Let alone billions of years.

5. Helium Diffusion

Okay, this one, I actually did have off the top of my head.

Most radioactive elements are alpha-emitters. They emit alpha particles (go figure). An alpha particle is made up of two protons and two neutrons stuck together. In other words, alpha-emitters release Helium atoms into the rocks wherein the alpha-emitters are found.

Helium can actually soak through solid rock, but very slowly. Now, if the Earth is 4.6 billion years old, there would have been plenty of time for the Helium to escape the rocks where alpha-emitting Uranium is found. But, if the Earth is only about 6000 years old, there would not be enough time for all the Helium to escape.

So, the question you should be asking is this: How much Helium is still in the rocks?

A lot. Enough, in fact, to set the age of the Earth to only about 5,680 years.

6. Another assumption made with the decay of U-238 is that the amount of Lead in the zirconium crystal is the same as the amount outside the crystal. Not a bad assumption, technically, but an assumption nonetheless. There are still other possibilities. Perhaps much of the Lead in the zircon was sequestered there in the same way that all of the Uranium was. Or perhaps there was no Lead at all in the zircon to begin with. Either of those scenarios would result in drastically different age calculations for the zircon-containing granite rocks.

This is yet another example of evolutionists taking an assumption and presenting it as a fact to students and the public.

You know, for all your accusations toward Christians, you evolutionists really have a tendency to take data and try to fit it into your presumptions.

7. The problem here is similar to the problem with the Uranium-Lead dating method. How much Argon was in the rock to begin with? Radioactive Potassium-40 is found naturally in fresh lava and volcanic ash. It automatically decays into Argon-40. Large amounts of Argon found in ancient volcanic rock, will cause the evolutionist to assign a large age to that rock. But it has been well-documented that fresh lava and volcanic ash can already contain significant amounts of stable Argon, right when it exits the volcanic source.

So, clearly, Argon content is no reliable way to determine the age of sample. The famous “Lucy” fossil, and many other so-called human “missing link” fossils have been dated by the Potassium-Argon method.

...All right. I'm tired of this one. I have three more things to bring up, but I don't really think it would make much of a difference at this point.

Okay, so on to the nylon-eating and "evolving" e coli. It would appear that a new function has been forced into each of these. But this raises some questions.

Was information (or another function(s)) lost during the gain of this new function?
(If more information was lost than gained, then this not actually a net gain of information, which is no help to evolution.)

And if scientists really are able to force bacteria to evolve new functions, then why have we not already forced bacteria to develop mitochondria and nuclei and such?
(My guess is that the nylon-eating bacteria had the ability to develop the function of eating nylon but not the ability to develop any other significant function. This is based on a very loose understanding of your replication-mutation, but even if my guess is wrong, my question still stands.)

I will be able to answer these questions once I research the "new functions" further, but until then, I still don't think that bacteria have the ability to evolve into eukaryotes. My main problem is the fact that scientists haven't been able to force them to do so yet. But another problem I have is viruses. Viruses "evolve" a million times faster than your standard bacteria or eukaryote. So. . . why haven't they evolved into something a million time more complex than humans? That's just another hurdle for evolution to fail to jump over.

Ooh, I found another Wiki page on endosymbiotic theory, and it has loads of evidence for it!

Ignoring the use of Wikipedia, I'll definitely be looking into your "evidence." But my problem with this is that I didn't find anything (and I skimmed, mind you) that actually said "Bacteria have been observed enveloping other bacteria and turning into mitochondria and/or the eukaryotic nucleus."

Let's take a close look at all this.

* Both mitochondria and plastids contain DNA that is different from that of the cell nucleus and that is similar to that of bacteria (in being circular in shape and in its size).

Okay. We've already discussed that in this thread. Mitochondria have DNA that kind of looks like prokaryotic DNA. That actually proves nothing.

* New mitochondria and plastids are formed only through a process similar to binary fission. In some algae, such as Euglena, the plastids can be destroyed by certain chemicals or prolonged absence of light without otherwise affecting the cell. In such a case, the plastids will not regenerate.

This I don't quite understand. So. . . we can destroy plastids. . . Great. . . How does that prove that mitochondria used to be a bacterium? And what is this "process similar to binary fission"? Has this process been documented?

* They are surrounded by two or more membranes, and the innermost of these shows differences in composition from the other membranes of the cell. They are composed of a peptidoglycan cell wall characteristic of a bacterial cell.

Okay. Again. They look kinda like bacteria. Great. But perhaps they have a peptidoglycan cell wall simply because they cannot perform their function otherwise. Perhaps they need it to survive.

* DNA sequence analysis and phylogenetic estimates suggest that nuclear DNA contains genes that probably came from plastids.

In other words: The DNA looks similar, so we assume bacteria turned into mitochondria. Key words above: "estimates" and "suggest." Not "facts" and "prove."

* These organelles' ribosomes are like those found in bacteria.

They look like bacteria...

* Proteins of organelle origin, like those of bacteria, use N-formylmethionine as the initiating amino acid.

Ooh, they use the same initiating amino acid! Proves nothing.

* Much of the internal structure and biochemistry of plastids, for instance the presence of thylakoids and particular chlorophylls, is very similar to that of cyanobacteria. Phylogenetic estimates constructed with bacteria, plastids, and eukaryotic genomes also suggest that plastids are most closely related to cyanobacteria.

Okay. They look like bacteria. Wonderful. And evolutionists think that bacteria turned into mitochondria. We have already established this.

* Mitochondria have several enzymes and transport systems similar to those of bacteria.

I'm getting tired of repeating myself...

* Some proteins encoded in the nucleus are transported to the organelle, and both mitochondria and plastids have small genomes compared to bacteria. This is consistent with an increased dependence on the eukaryotic host after forming an endosymbiosis. Most genes on the organellar genomes have been lost or moved to the nucleus. Most genes needed for mitochondrial and plastid function are located in the nucleus. Many originate from the bacterial endosymbiont.

Finally. Something different. Here's what the above means: We evolutionists have a model, and we have managed to fit a piece of it into the data. This actually proves nothing.

* Plastids are present in very different groups of protists, some of which are closely related to forms lacking plastids. This suggests that if chloroplasts originated de novo, they did so multiple times, in which case their close similarity to each other is difficult to explain.

Cells have plastids. Protists have plastids. Proof? No. But I like the "difficult to explain" part. Kinda funny that they put this in the "evidence" section.

* Many of these protists contain "primary" plastids that have not yet been acquired from other plastid-containing eukaryotes.

The protists have plastids that the cells don't. Proof? Nope.

* Among eukaryotes that acquired their plastids directly from bacteria (known as Primoplantae), the glaucophyte algae have chloroplasts that strongly resemble cyanobacteria. In particular, they have a peptidoglycan cell wall between the two membranes.

So, we're repeating ourselves about the peptidoglycan wall again, but this time, we prefixed it with "Among the cells that evolved..." Don't you just love presuppositions?

* Mitochondria and plastids are similar in size to bacteria.

And again. . . They look kinda like bacteria.

So what we've actually established is that bacteria can live inside other bacteria.

Well, of course. It's the bacteria randomly eating another bacteria that never occurs.

6. Meaningless - you don't need to physically see something to prove it happened, you just need evidence.

You mean speculation?

In very minor ways, they may have, but huge differences are probably absent.

I disagree. They're exactly the same -- outwardly, anyway.

If their senses are already enough to allow them to survive adequately in their environment, they have little requirement to hone said senses.

You didn't answer my question. It doesn't matter if they didn't need to develop better senses. Mutations happen randomly, so my question is this: If a coelacanth mutated significantly better senses, would that trait spread throughout the population or not?

And what would a fish without lungs do with feet?

What would a fish without feet do with lungs?

I encourage you to look up coelacanths and why scientists once thought that they evolved into humans. It's because they have these little appendages that allow them to prop themselves up on the ocean floor. Evolutionists looked at it (just like they do bacteria) and said, "Hey, it kinda looks like they had feet. Proof! Humans must have evolved from coelacanths!" But then, we found coelacanths living in the Indian Ocean, and the evolutionists decided that we evolved from the lungfish instead.

If they provided a significant survival advantage, yes. If they did not, because the rest of the species is breeding at an equal rate, probably not - at least not to the degree that other mutations in other species have.

So, would better eyesight or feet be considered a "significant survival advantage"? If so, then my point stands.

No, feet would not be a significant change in an organism that has absolutely no use for them.

Actually, coelacanths would have plenty use for them.

And, without quoting you further, I would like to point out something:

"Most of the differences between species evolved in the diversification of species and genera, the lower categories of taxa, and are presumed to be adaptive specializations without an obvious advance in overall grade of complexity. These changes can be called lateral radiations."​

That is from evolutionist T.H. Bullock. What this means is that species and genera come mostly from diversification (loss or shuffling about of DNA), not from evolution. In other words, breeding. Not evolution. Coelacanths might have lost DNA, but they certainly haven't evolved. This is a point I've been trying to make from the start.

I would also like to cite the rarity of full fossils. The fact that we haven't found fossils of every single modern species of coelacanths does not necessarily mean that coelacanths have changed. It could also mean that we simply have not discovered their fossils.

And you might want to be absolutely sure that the fossils we do have are not of currently-existing coelacanths. Because then my point still stands.

I'd really like some clarification of which part of the Cambrian explosion we're supposed to address.

The part where every phyla shows up abruptly.

Called polystrate fossils (or upright fossils in geology), most of them can be explained by "brief periods of rapid sedimentation" - as in, they were buried really quickly, before they could be knocked down. Rockslides, landslides, mudslides, things like that are probably the case in most if not all of them. Upright fossils are typically found in layers associated with an actively subsiding coastal plain or rift basin, or the accumulation of volcanic material around a periodically erupting stratovolcano. So basically, they exist because the tree was buried very quickly and rapidly while still upright.

Um, yeah, there are polystrate fossils near Mt. St. Helen's. But the slides and explosions do not account for all of them.

(By the way, this has been bugging me. You earlier implied that the flood was strong enough to shear the tops off of mountains, but are now saying that the fact that a tree was fossilized upright is also evidence of the flood. So, what, this flood was strong enough to rip apart mountains, but not strong enough to knock down a tree? Really?)

It all depends on where the trees and mountains were. If the Arbuckle Mountains were near the eruption of the supervolcano, they could have easily been beheaded while the trees on the other side of the world were simply fossilized. You might as well ask "Why did the Flood fossilize some creatures but just drown the rest?" It's a flood. The force of the water on the Arbuckle Mountains was not equal to the force of the water on the polystrate trees.

But again, I am not a Flood expert. Nor a geologist. If I were, I could give you a much more satisfying answer.

... Really. "I know that I was totally wrong with my argument about these organs being irreducibly complex and how they didn't have to evolve all at once, but maybe if I pick different organs and repeat the exact same argument nobody will notice!" Are you going to do this with every single organ?

1. Y'know, most people appreciate it when someone admits that he was wrong.
2. I never used the irreducible complexity argument.
3. And, uh, yeah, pretty much. I want answers to every question. Why else research?

And the answers didn't actually answer the question. I know very well that evolutionists believe that the liver formed gradually, but the first response simply said that the liver was made up of cells that formed gradually into the liver (still doesn't answer the question of how the liver survived long enough to do this), and the second response just attacked the creationist.

---

Now, again, back to the flood. I'm not trying to prove that the Flood occurred. I'm proving that the Flood is a reasonable explanation.

And sorry I couldn't provide a species and genera for my exploding fish. I'm working off the top of my head here. I'll gladly name the fish as soon as I find the article I initially read about it in. And I would like to point out that the fossil had the head still attached.

Let me go over the four gene pools again. Noah's family. Noah's three sons. Noah's wife. Noah's daughters. All one gene pool. The three wives of Noah's three sons. Three more gene pools. Altogether, there are four. Unless you think that Noah's sons married their own sisters.

Now, I don't think I could ever convince you of this, but evolution is a model. And evolutionists take this model as fact. They then look at the evidence and try to fit it to their model. Evolution is the only model that evolutionists fail to recognize as such.

And, in regards to the surface area thing, I think you've got it backwards. If the mountain is the pencil and the trees are the needles and the water the skin, then I think the trees would cut through the water with more ease than the mountains.

I explained this earlier, we date the fossils using radiometric dating on the fossils themselves.

You'd be surprised.

Institute for Creation Research that sounds unbiased.

So. . . Let me get this straight. Evolutionist sources are okay, but creationist sources are not? Both are equally scientific, whether you want to accept it or not. So, what you're telling me is, "That scientist disagrees with me, so whatever he says doesn't count!"

Right.

You have a double-standard. For instance:

... Not really. There's plenty of natural ways that could have occurred - a significant fire in the area clearing out all the trees, migration of horse ancestors from woodland to grassland, or - bear with me, because this might sound ridiculous - a regular old run-of-the-mill flood. See? No supernatural explanation required!

Okay, so you can propose possibilities, but I cannot. The Flood is a possibility. Evolution is a possibility. I accept the first and reject the second. You reject the first and accept the second.

Now, I could easily go through quote everything you say here on out, but it's overwhelmingly clear that regardless of the facts (and interpretation thereof) I may provide for you, you simply will not accept my argument. But I expected as much. Nobody ever wins an internet debate.

God bless.
----------------------------------------------------------------

In conclusion,

Prokaryote to Eukaryote -- Not answered sufficiently.
Coelacanths -- Not answered sufficiently.
Cambrian Explosion -- Not answered.
Polystrate Trees -- Not answered.
Incipiency of the Liver -- Not answered.
Missing Links -- Not answered.

So, good. I now have some good questions to ask when I meet an educated evolutionist in person. Maybe it will make sense later, though I suspect that it will not.

The fact is, evolution is a model. It is filled with presuppositions just like any other model. Creation is a model too. I just think the evidence points to creation more than to evolution. That doesn't make me stupid. That doesn't make evolutionists stupid. It just means that we disagree. I do my best to understand the evolutionist's view of the data whenever I confront new data, but I continually find the evidence favorable toward the Creation model. That's all.

Now, no matter what the facts say, this debate isn't going anywhere. This is because we all have our presuppositions, and these presuppositions lead to emotional reactions rather than logical responses. It has already become too negative for me, so in the interest of my sanity, I won't be reading or responding to this thread again. Beside that, I simply do not have the time. All that said, I have taken notes and will continue to research the data presented in your arguments.

God bless!

 

[Megaton666]

Listen, we OBSERVED evolution. Game over! You lose!

 

[Pesky Persian]

Listen, we OBSERVED evolution. Game over! You lose!

That was a mature way to handle things.

 

[KiraRebornXD]

Yeah somewhat I guess.

 

[ebilly99]

These gaps may be filled in already or in the future, but just b/c we do not understand it today does not mean it is wrong. To put ones eggs in a basket is a terrible idea b/c you have no where to run when these gaps are filled.
We also do not understand spacetime to its fullest. There are a ton of gaps in it (IE if we do not move reletive to anything will time move infinitly fast?) so to say evolution is wrong b/c you do not understand is a Falisy from ignorance. I am sorry but even if these gaps exist they do not prove of disprove ID.

 

[mattj]

I don't think that gaps in evolution "prove" ID. They just show that evolution is a theory that actually does currently have weaknesses. It's not "fact" and it's no reason to throw your faith away.

 

[ebilly99]

I don't think that gaps in evolution "prove" ID. They just show that evolution is a theory that actually does currently have weaknesses. It's not "fact" and it's no reason to throw your faith away.

It is the best guess for the information provided. We have not found one thing in nature that says evolution did not happen, Nothing that we can look at that could not arive through natural selection and mutations. While you can point to things not explained, (Or things that have been explained yet you ignore) you can not point to one reason this rule of the universe is wrong. If your faith hinges on wether one scientific law is true or not perhapes it is time to re-evalute your faith. If it is not strong enough to live in the modern times perhapes it is time to let it die. If it is then there is no reason to argue against science

 

[mattj]

I'm sorry, but the many problems with evolution that users here in this thread have already posted are most definitely more than

one reason this rule of the universe is wrong

Only the severely uninformed, or the dishonest, would try to assert that our current understanding of Evolution has no legitimate flaws.

 

[ebilly99]

I'm sorry, but the many problems with evolution that users here in this thread have already posted are most definitely more than

Only the severely uninformed, or the dishonest, would try to assert that our current understanding of Evolution has no legitimate flaws.

Well I guess I am Uninformed. How does survival of the fittest (Everything dies, the best for a enviroment have kids) and Mutations (While most are harmful, even mutations that look like they do nothing can become benifical) have any legitmate flaws. (Domt say how we don't understand how x happened. I can name 50 ways that it could happen.) Name problems with the theroy

 

[Pesky Persian]

and it's no reason to throw your faith away.

You don't have to "throw your faith away" to agree with evolution. The Abrahamic religions are not the only ones with creation myths. And there are plenty of religions that don't have creation myths. To assume that one must throw away their faith in whatever religion they have to accept a scientific theory is pretty silly, if you ask me. Science and religion don't have to be separate. They don't have to combat each other at all. It is not the intent of one to disprove the other.

 

[mattj]

Well I guess I am Uninformed. How does survival of the fittest (Everything dies, the best for a enviroment have kids) and Mutations (While most are harmful, even mutations that look like they do nothing can become benifical) have any legitmate flaws. (Domt say how we don't understand how x happened. I can name 50 ways that it could happen.) Name problems with the theroy

Problems have already been named. No point in picking the scab again. Whether or not you personally deem those problems to be enough to discard the theory in whole is not the issue. Those problems exist, and have already been explained itt.

You don't have to "throw your faith away" to agree with evolution. The Abrahamic religions are not the only ones with creation myths. And there are plenty of religions that don't have creation myths. To assume that one must throw away their faith in whatever religion they have to accept a scientific theory is pretty silly, if you ask me. Science and religion don't have to be separate. They don't have to combat each other at all. It is not the intent of one to disprove the other.

Oh, I agree. My worship leader wholeheartedly accepts evolution. I don't personally accept it as an accurate mechanism to describe the diversity we see around ut, but I can see how serious people of faith could accept it. The point of my comment was to address those who would say "Evolution PROVES the Bible is wrong!" etc

 

[Rezzo]

Unfortunately I don't have the time (or mental capacity) to make a massive post like some people here, but I'll contribute.

Oh, I see. So, only the beneficial traits get passed along? Yet humans have harmful traits. What's up with that? See, it looks like, to me, that no matter how many beneficial traits get passed on, something harmful will too. Eventually, you know, those harmful traits are going to build up. Humans' sheltered existence has sped up the buildup, sure, but I don't think buildup would just stop, even if we weren't so sheltered.

Would it stop?

Yes you are correct in stating that both beneficial and harmful traits get passed along, but even with a sheltered existence most genetic traits of the harmful nature will come to a stop.

A person with this harmful trait will be hindered from reproduction. Maybe not sexually, but they are likely to be set-off from actually finding a long term partner and reproducing. While there is likely to be some people who do manage to escape the boat and carry on reproducing, the majority who do not have these harmful traits.

Another important factor would be if the other partner actually has the trait as well. You should know that for any genetic trait of any kind, the trait only has a 37.5% chance (very likely to be lower than this due to the unlikelihood of both parents also passing on the trait to the partner in this example, due to what I am about to explain) of being inherited if it is belonged to 1 partner. If this select couple has 12 children, then there is a good chance that between 3 and 6 of these children inherit this bad trait.

Now you have to consider whether this trait is a dominant or recessive allele, and whether it is affected by other factors. If it happens to be recessive, then it is very unlikely to survive, depending on entire luck. However if it is dominant, then this trait will cause the person to be less sexually appealing, and lower their chance of sexual reproduction.

With beneficial traits, these tend to be more sexually appealing; therefore gaining more chance of reproduction. Yes, these traits will have the exact same chance of being inherited as hindering/harmful traits, but they are less likely to be lost due to higher chance of reproduction.


My argument to this point? harmful traits will decrease. Whether they will stop or not is a mystery. It's hard to make an estimate on such a population as ours, but you cannot rule out the possibility.

 

[ebilly99]

Problems have already been named. No point in picking the scab again. Whether or not you personally deem those problems to be enough to discard the theory in whole is not the issue. Those problems exist, and have already been explained itt.

Every method to disprove evolution has been debunked. But lets start with the whole Information can not be added Bull
here is a example. aacattacagattacaagattacaagatt. Lets say this adds a chemical for sugar now for the mutation that adds information. We copy all of this and mutate the Magenta aacattacagattacaacattaga
Now we have information for sugar and a code for sulfuric acid (I know that this is not exact but it close enought to get the point. I have added a code for more information through duplication and mutations. The net info is Greater Then Before.

 

[mattj]

and?
tenchar

 

[J.T.]

Just as I'm trying to think of a term one step beyond "facepalm" and "headdesk" to describe what went on between Snorunt and mattj, the debate gets going again. Sweet.

I know you're not gonna be on the thread anymore, but since the thread'll probably still be going, I'll answer anyway.

First, I don't care to look at charts. Really. I like real information I can look into. Charts prove nothing. All they do is show how evolutionists think things evolved, and I don't even buy evolution to begin with.

That's no excuse. Charts can and do provide information, and along with most of the charts I've posted, I also gave "real information" in support of evolution.

All I remember is "Blah blah blah, evolution is a fact, blah blah, we don't assume, we know, blah blah yada, creationists don't ever have proof, blah yada."

Okay, so you didn't ignore all of it, you just read select parts of it that you could use to turn into strawmen. Nice.

Ignoring the purple-trees analogy for the sake of willing suspension of disbelief and powering on ahead...

Okay, see, while natural selection can cause a particular trait to spread throughout an animal group, it cannot produce such a trait. Therefore, natural selection alone cannot turn worms into chickens. It just doesn't happen.

So yes, natural selection is part of the hypothesis of evolution (just messing with you), and yes, natural selection does result in a sort of change, but no, natural selection is not enough to turn chemicals into chemists.

Few things here.

First, I never said natural selection was all there is to evolution. It is a very large part of it, because it is the largest way in which genes and traits become abundant in the gene pool, but no, it is not the sole mechanism of evolution. The theoretical "purple trees" scenario would require moths to adapt somehow - not necessarily turning purple, but maybe by becoming smaller to be harder to find or to hide in small spots where predators can't reach them; or by becoming more agile to avoid predators chasing them; or any sort of variety of different adaptations. Natural selection would be what ensures that adaptation becomes widespread.

Second, an example of natural selection is still good evidence for evolution. Even though you don't agree with it, you clearly have at least some understanding of what evolution is - otherwise you'd have made a fool of yourself ten pages back. So you know that evolution is the process by which species change and adapt to their environment through the passing of favorable/beneficial genes to offspring, correct? Now, you're basically saying that an example of species changing and adapting to their environment through the passing of favorable/beneficial genes to offspring... is not evidence of a theory that describes species changing and adapting to their environment through the passing of favorable/beneficial genes to offspring. Hopefully you can see where I'm having issues with your line of thought.

The evolution creationists have a problem with is the one that claims that a puddle of chemicals just happened to come together in just the right way to form life, which then became every living organism on the face of the Earth. And that evolution requires the increase of genetic information.

Face-freaking-palm.

There are mutations that increase genetic information. I have explained two different ways by which it can happen (a duplication mutation during DNA replication or mRNA translation which results in a section of DNA being repeated (on that note, I should mention that there's no specific number of bases that are duplicated in such a mutation - sometimes it's just one, sometimes it's more), and nondisjunction during cellular division in meiosis and mitosis). In addition, there are a few chromosomal aberrations that result in - yes, I know - exchange of genetic information. Screw it, let's just make it easier by listing all the types of chromosomal abnormalities I can think of.

- Deletion: exactly what it sounds like. Deletes a section of a chromosome. Loss of information.
- Inversion: The reversing of a section of chromosome. For example, the segment AGA CTA GCU Might become AGG ATC ACU. Flipping of information.
- Translocation: Part of a chromosome breaks off and attaches to another chromosome. Sometimes the chromosomes exchange parts. Exchange of information.
- Duplication: A section of the chromosome is repeated. Increase in information.
- Ring mutation: A chromosome loses part of its ends and becomes circular. Yes, we have observed this. No real change in information, but I would imagine it being a hell of a lot harder for human mRNA to read a circular chromosome.
- Isochromosome: Mirror image copy of an "arm" of the chromosome. Change in information, and because some chromosomes have one arm larger than the other, can also result in an increase in information.

In addition, the aforementioned nondisjunction, when chromosomes fail to separate during cellular division, resulting in one cell having an extra chromosome. Exchange/increase in information.

Okay, next, I do not have to prove that God exists right now. That is not the point of this discussion. I'm here to talk about evolution. I am a creationist, though, so for the sake of discussion, we have to compare different possibilities, including the possibility (*cough*, fact) that God did create everything. See, in this thread, our usual roles are reversed. This time, Darwin has to answer for his claim.

I wouldn't act as if you're special, a lot of people try the same thing. The fact that evolution has stuck around despite that is evidence of its staying power.

But more to the point. I would be fine with you saying you don't have to prove God exists... If you were only arguing against evolution. But you're not. You are arguing against evolution and saying that creationism is the only alternative. If you want to avoid arguing for the existence of God, then you'll have to stop trying to argue that creationism is true.

Oh, don't get me wrong. It did mix things around, I'm sure. But, especially with the eruption of a supervolcano,

Who said anything about a supervolcano, and how would that affect anything? (I know supervolcanos exist, they were mentioned in a book I have on my desk right now, but I'm not sure how that would change anything.)

the bottom-dwelling ocean creatures would have still fossilized at the bottom. Unlucky land creatures would have fossilized above that. Some would have fossilized above the others because of all the mixing around.

Okay, in lieu of arguing against that, I'll go back to the fact that all the fossils are different ages, with the oldest on the bottom and the youngest on the top. Which would mean some serious problems if they were all fossilized at the same time. Yeah, yeah, I know, "radiometric dating is unreliable" blah blah blah I'll get to that in a moment.

Lots of things have been shown to speed up the decay rates of radioactive unstable elements. The most extreme is high-energy heating, such as in the plasma state. At that high a temperature, unstable atoms decay at even trillions of times their usual rate. This is funny, because evolutionists believe that the who universe was on in the plasma state. Our sun is too, as is every bolt of lightning. In our atmosphere.

Other effects have been noted in other changing conditions such as underground temperature, pressure, and magnetic field. In 2010, it was discovered that every 38 days in the solar cycle, Cesium atoms here on Earth decay faster – the effect is even greater during times solar flare activity. The evolutionists’ mantra of “constant decay rates” has now been proven – by science – to be nothing but an urban myth. It is not true. It cannot be offered in evidence for an Earth older than 6000 years.​

"I have a quote-unquote-expert who agrees with me who made this quote, but I won't source the quote or even tell you who the hell said it"

Like you, I am not much of a geologist - my scientific specialty is biology, which is kind of why I bothered with this topic - and therefore I'm going to have to look at others more knowledgeable of this topic to explain your claims. Unlike you, though, I will give links and sources to every claim I make. To start with, in regards to this quote of yours:

Rates of radiometric decay (the ones relevant to radiometric dating) are thought to be based on rather fundamental properties of matter, such as the probability per unit time that a certain particle can "tunnel" out of the nucleus of the atom. The nucleus is well-insulated and therefore is relatively immune to larger-scale effects such as pressure or temperature.

Significant changes to rates of radiometric decay of isotopes relevant to geological dating have never been observed under any conditions. Emery (1972) is a comprehensive survey of experimental results and theoretical limits on variation of decay rates. Note that the largest changes reported by Emery are both irrelevant (they do not involve isotopes or modes of decay used for this FAQ), and minuscule (decay rate changed by of order 1%) compared to the change needed to compress the apparent age of the Earth into the young-Earthers' timescale.​

- Chris Stassen, The Age of the Earth, TalkOrigins (link to quote and additional information). Emphasis mine.

Next, there's the problem of knowing the original amount of isotope. See, when evolutionists see very little of a particular isotope in a rock, they assume that the rock is very old. But couldn't there have just been very little isotope in the rock to begin with?

I'm almost certain I know the answer to this one myself. I'm fairly certain they compare the amount of unstable isotope to the amount of decay product. However, I'll get into this in a moment, when I address the below points.

They try to do A-B=C, but by assuming what A is. That leads to an inaccurate C.

Again, that is not how the formula works. The formula is actually:

[IMG139]http://talkorigins.org/faqs/isochron-dating/equatn-1.gif[/IMG139]

Again, they find the amount of both parent and daughter isotopes, and compare them. Yes, that leaves the problem of how much daughter isotope was initially in the sample. But I'm getting to that.

So, when they find lots of lead in a sample, evolutionist researchers tend to assume that much of the stable element (or that the whole of it) actually did come from the unstable atom decaying, and not from just being there in the rock to begin with.

The question you should be asking is "Can stable elements like that be in rocks to begin with?"

"Decay products" end up in rocks all the time without actually resulting from decay. Lead doesn't always come from Uranium-238.

I was looking for information on this, and came up with a page on isochron dating, which addresses the problems you're talking about here. First off, the page admits that this problem exists with many generic radiometric dating methods - they assume that the daughter isotope was initially at zero in the sample. However, it adds this in regards to that:

Note that the mere existence of these assumptions do not render the simpler dating methods entirely useless. In many cases, there are independent cues (such as geologic setting or the chemistry of the specimen) which can suggest that such assumptions are entirely reasonable. However, the methods must be used with care -- and one should be cautious about investing much confidence in the resulting age... especially in absence of cross-checks by different methods, or if presented without sufficient information to judge the context in which it was obtained.​

And the page I linked earlier also mentions this immediately below the part I quoted:

2.2 Contamination may have occurred.

This is addressed in the most detail in the Isochron Dating FAQ (I linked this above), for all of the methods discussed in the "age of the Earth" part of this FAQ are isochron (or equivalent) methods, which have a check built in that detect most forms of contamination.

It is true that some dating methods (e.g., K-Ar and carbon-14) do not have a built-in check for contamination, and if there has been contamination these methods will produce a meaningless age. For this reason, the results of such dating methods are not treated with as much confidence.

Also, similarly to item (1) above, pleas to contamination do not address the fact that radiometric results are nearly always in agreement with old-Earth expectations. If the methods were producing completely "haywire" results essentially at random, such a pattern of concordant results would not be expected.​

- Chris Stassen, Isochron Dating and The Age of the Earth, TalkOrigins

Second, isochron dating was created with these issues in mind. The formula has a built-in check against such contamination. This was the dating method used to find all ages in the Age of the Earth section of TalkOrigins. In addition, we don't use just one dating method and call it a day. We use multiple different dating methods and compare the results obtained.

Evolutionist researchers assume that the rock sample has remained undisturbed by anything that could have affected its decay rate or parent isotope amount or daughter isotope amount – for billions of years. Highly unlikely. In fact, it is highly likely that something did, in fact, disturb a three-billion year-old sample.

See my quote above. No, further above, the one from Chris Stassen. No, the other one from Chris Stassen.

Helium can actually soak through solid rock, but very slowly. Now, if the Earth is 4.6 billion years old, there would have been plenty of time for the Helium to escape the rocks where alpha-emitting Uranium is found. But, if the Earth is only about 6000 years old, there would not be enough time for all the Helium to escape.

So, the question you should be asking is this: How much Helium is still in the rocks?

A lot. Enough, in fact, to set the age of the Earth to only about 5,680 years.

... Oh, sweet! Dr. Kevin R. Henke actually had an entire page on TalkOrigins dedicated to this claim. This one's pretty damn long, so I'll just skim it and find some sections you should read. Hit Ctrl + F on the page linked and copy-paste the following search terms to get to teach section quicker:

- MYSTERIOUS MODIFICATIONS OF THE HELIUM (Q) MEASUREMENTS FROM GENTRY ET AL. (1982a): MORE QUESTIONS THAN ANSWERS
- MISSING AND QUESTIONABLE a VALUES
- The Information in Dunai and Roselieb (1996) that Dr. Humphreys Doesn't Want You to See
- MORE REALISTIC HELIUM DIFFUSION MODELS IN LOECHELT (2008c) SUPPORT AN ANCIENT EARTH

For more fun, under the section "DR. HUMPHREYS FUDGES SOVIET HELIUM DIFFUSION DATA TO SUPPORT HIS AGENDA", one of the "scientists" who pioneered this helium-diffusion-as-proof-of-young-earth thing was later proven to have changed the units on a Soviet scientific graph measuring helium decay - he changed a natural log to a base 10 log and argued that it supported his hypothesis. That's like if I took that quote up there from you:

"Enough, in fact, to set the age of the Earth to only about 5,680 years."

... and changed it to this:

"Enough, in fact, to set the age of the Earth to only about 5,680 millenia."

... and then followed it up by saying "Hey everybody! Abundantly supports me! I win!" It's childish, unscientific, and mindbogglingly stupid. And again, I only skimmed this page.

Another assumption made with the decay of U-238 is that the amount of Lead in the zirconium crystal is the same as the amount outside the crystal. Not a bad assumption, technically, but an assumption nonetheless. There are still other possibilities. Perhaps much of the Lead in the zircon was sequestered there in the same way that all of the Uranium was. Or perhaps there was no Lead at all in the zircon to begin with. Either of those scenarios would result in drastically different age calculations for the zircon-containing granite rocks.

Going to need some context on this one. What do zircon crystals and the difference of lead content inside and outside have to do with anything? And again, we use multiple dating methods and compare the ages given - and if the problem you've described really is a problem, it may well be covered by isochron dating.

You know, for all your accusations toward Christians, you evolutionists really have a tendency to take data and try to fit it into your presumptions.

When the data doesn't fit anywhere else that we're aware of, it's kind of hard not to.

How much Argon was in the rock to begin with? Radioactive Potassium-40 is found naturally in fresh lava and volcanic ash. It automatically decays into Argon-40. Large amounts of Argon found in ancient volcanic rock, will cause the evolutionist to assign a large age to that rock. But it has been well-documented that fresh lava and volcanic ash can already contain significant amounts of stable Argon, right when it exits the volcanic source.

Oh, look at that, I've addressed this already in three different ways. Isochron dating, multiple dating methods, no examples of significant changes in rate of decay... really, just reread everything I've said to this point.

So, clearly, Argon content is no reliable way to determine the age of sample. The famous “Lucy” fossil, and many other so-called human “missing link” fossils have been dated by the Potassium-Argon method.

Somehow I doubt a scientific find as large as Lucy would be dated with only one method, especially when K-Ar dating is acknowledged to not have a built-in check to contamination and is therefore given less confidence than other dating methods.

Okay, so on to the nylon-eating and "evolving" e coli. It would appear that a new function has been forced into each of these. But this raises some questions.

Was information (or another function(s)) lost during the gain of this new function?
(If more information was lost than gained, then this not actually a net gain of information, which is no help to evolution.)

Oh my holy ****ing god do you read anything that I post I have repeated this so many times already. Do you need emphasis for it this time? Fine. Evolution does not require an increase in information, only a change in information. I shouldn't have to repeat myself this often.

And if scientists really are able to force bacteria to evolve new functions, then why have we not already forced bacteria to develop mitochondria and nuclei and such?

If I recall correctly, the nylon-eating bacteria evolved that ability without human intervention, unless "creating nylon hoping it wouldn't be eaten by bacteria" qualifies as human intervention.

And why haven't we made certain prokaryotes develop mitochondria and nuclei yet? Like I said before, the prokaryotes that lack nuclei and mitochondria clearly do not have an overpowering need for those organelles. If we're going to have a cell get a nucleus or mitochondrion through endosymbiosis, we're going to have to find a living example of one of those outside a cell. That may pose a problem.

But another problem I have is viruses. Viruses "evolve" a million times faster than your standard bacteria or eukaryote. So. . . why haven't they evolved into something a million time more complex than humans? That's just another hurdle for evolution to fail to jump over.

Because evolution doesn't just happen for shits and giggles. It's supposed to help the organism survive in its environment, and if they survive just fine right now, then why do they need to change significantly? Also, you picked a bad example. Viruses aren't living things - at least, not by traditional definitions of "living things". For starters, they can't reproduce on their own. They have to inject their genetic material (which can be formed by either DNA or RNA - viruses are the only things that can have RNA as their genetic material instead of DNA) into other cells so it can be translated, read, and transcribed into new viruses. Furthermore, you're assuming viruses existed at the beginning of life, which may or may not be true.

But my problem with this is that I didn't find anything (and I skimmed, mind you) that actually said "Bacteria have been observed enveloping other bacteria and turning into mitochondria and/or the eukaryotic nucleus."

And I didn't see any note at the crime scene that said "Ted Bundy killed me, signed victim". That doesn't mean he didn't do it, all it means is that we need to look at the evidence and make a decision.

Okay. We've already discussed that in this thread. Mitochondria have DNA that kind of looks like prokaryotic DNA. That actually proves nothing.

... No, it proves a lot, actually. You know how we can do DNA testing to reveal who a child's parents are? It's pretty much like that, knocked back many generations. And it's even easier when we're talking about unicellular organisms, who create exact copies (or nearly exact, what with mutations and such) of themselves when reproducing rather than mixing genetic information with a partner as in sexual reproduction. You seem to keep undervaluing the similarities of DNA in organisms, as if it's "some sort of coincidence" - or trying to fit it into your assumption that God must've made everything, but let's not get into that.

This I don't quite understand. So. . . we can destroy plastids. . . Great. . . How does that prove that mitochondria used to be a bacterium? And what is this "process similar to binary fission"? Has this process been documented?

- It's saying that the plastids will not regenerate after being destroyed, but the cell can survive without them. This suggests that the plastids came about only recently, and the cell hasn't yet evolved dependency on them. And this I don't quite get. One minute you're arguing for incipiency ("everything had to evolve at once/it's too complicated to have evolved"), and then when you're provided with an example of why incipiency is wrong, you act like it's nothing at all.
- From Wikipedia: "Mitochondria divide by binary fission similar to bacterial cell division; unlike bacteria, however, mitochondria can also fuse with other mitochondria.[62][78]" So to answer your question, it basically divides exactly how a regular prokaryote would, with the difference being that it can fuse with a second mitochondrion. And yes, we've observed this. It kind of has to happen whenever a cell undergoes mitosis.

Okay. Again. They look kinda like bacteria. Great. But perhaps they have a peptidoglycan cell wall simply because they cannot perform their function otherwise. Perhaps they need it to survive.

Plenty of conjectures and "maybes" - as in, "that's kind of compelling, but maybe this happened instead, or maybe this, or maybe that, or maybe these" - but I don't see anything to support such conjecture.

In other words: The DNA looks similar, so we assume bacteria turned into mitochondria. Key words above: "estimates" and "suggest." Not "facts" and "prove."

"Estimates" does not mean "we rolled a couple dice and wrote down what we got". Saying "it's an estimate so it might be wrong" isn't much better than the-- um, can I call them idiots? I'm not sure if that counts as flaming if they haven't actually said it yet - who think they can argue against evolution simply by saying "it's just a theory!"

And that argument's especially useless when these "estimates" come from directly comparing mitochondrial DNA to other prokaryotic DNA.

They look like bacteria...

If it looks like a duck, walks like a duck, acts like a duck, quacks like a duck, and has a genome very similar to that of a duck... Seriously, cut this undervaluing of points out.

Ooh, they use the same initiating amino acid! Proves nothing.

Should point out that everything else other than bacteria uses methionine as the initiating amino acid. Only bacteria - that is, prokaryotes - use N-formylmethionine. Only bacteria. Hmmmmmm

Okay. They look like bacteria. Wonderful. And evolutionists think that bacteria turned into mitochondria. We have already established this.

Once again, if it walks like a duck, acts like a duck, and quacks like a duck...

I'm getting tired of repeating myself...

Believe me, I know how you feel.

Finally. Something different. Here's what the above means: We evolutionists have a model, and we have managed to fit a piece of it into the data. This actually proves nothing.

... So, what, because we came up with this evidence after we developed the theory of endosymbiosis, we must have just interpreted it to fit the data, and therefore it's invalid? Convenient out you've got there - if you don't want to argue against something, just say "it's a presupposition", and poof! no need to make an actual argument against it. And yeah, I accuse you of interpreting evidence to fit your own predetermined view, but I don't use such claims to get out of using an argument. I provide an argument alongside such a claim, so I can prove it as well as point out your bias and stubbornness (and as of now, hypocrisy).

Cells have plastids. Protists have plastids. Proof? No. But I like the "difficult to explain" part. Kinda funny that they put this in the "evidence" section.

It's possible that they all enveloped and incorporated plastids into their system at the same time (or close to each other) and branched off later, where one later lost the need for plastids; or that the first prokaryote to incorporate plastids had something branch off and later become protists, which branched off again where one had no need for plastids; or maybe plastids just didn't evolve much. But I freely admit I don't have an explanation for this one.

So, we're repeating ourselves about the peptidoglycan wall again, but this time, we prefixed it with "Among the cells that evolved..." Don't you just love presuppositions?

This one's talking about eukaryotes, but yeah, it seems to be the same argument rephrased. However, that argument's still just as good as it was the first time around (despite you refusing to believe it's any good). And what exactly makes you think any interpretation of evidence that disagrees with your view is a "presupposition"?

And again. . . They look kinda like bacteria.

**** it, I'm done with all this undervaluing of evidence and pointless conjecture. If you have another scientifically sound explanation for why mitochondria and plastids are so uncannily similar to prokaryotes in nearly every way - physically similar, genetically similar, and behaviorally similar - let's hear it.

You mean speculation?

Head****ingdesk. Yes, after everything I've posted as evidence of endosymbiosis - none of which by the way you've had any response to besides repeating "THIS PROVES NOTHING", presumably with your head in the sand the entire time - we can clearly call endosymbiosis "just speculation".

You didn't answer my question. It doesn't matter if they didn't need to develop better senses. Mutations happen randomly, so my question is this: If a coelacanth mutated significantly better senses, would that trait spread throughout the population or not?

I thought I'd made it plainly obvious that the answer is "no, most likely not, because if its senses are already adequate, it wouldn't be a significant survival advantage".

What would a fish without feet do with lungs?

Same thing a snake without feet does with a lung? I'm pretty sure lungfish can stay on land for short periods of time.

I encourage you to look up coelacanths and why scientists once thought that they evolved into humans. It's because they have these little appendages that allow them to prop themselves up on the ocean floor.

Oh, cool. The More You Know and all that, I guess.

Evolutionists looked at it (just like they do bacteria) and said, "Hey, it kinda looks like they had feet. Proof! Humans must have evolved from coelacanths!" But then, we found coelacanths living in the Indian Ocean, and the evolutionists decided that we evolved from the lungfish instead.

Yes, and? Assuming we did at one point think that, it's just an example of science marching on. See, science admits when it's wrong, or when information casts current scientific theories/hypotheses/etc. into doubt or disproves them altogether. We adapt the newfound information into our current scientific knowledge, rework what we already know to fit with what we've just discovered, and discard whatever can no longer stand with the new information.

Also, I'm fairly certain this assumption would have been made before genetics became a widespread field. Just sayin'.

So, would better eyesight or feet be considered a "significant survival advantage"?

Depends. Do they need feet in their current environment? If so, then yes. If not, then no. And is their current eyesight already sufficient in their environment? If so then no, if not then yes.

Actually, coelacanths would have plenty use for them.

Such as...? If these aforementioned "appendages" are sufficient for them in their environment, then they don't really need feet.

quote​

That is from evolutionist T.H. Bullock. What this means is that species and genera come mostly from diversification (loss or shuffling about of DNA), not from evolution. In other words, breeding. Not evolution.

... "Diversification", not "evolution". So you think that organisms within families not only develop into different species, but into different genera... but that's not evolution. I'm not even going to bother arguing against that Bullock guy's quote because I don't know or care if he's right, but holy ****. If the development of an organism into many various species (and various genera, which have within them even more various species) through mutation, sexual selection, and natural selection isn't evolution, what the hell do you think evolution is? Hell, where did this guy even say that that's not an example of evolution? All I see is him saying "diversification causes most variations in genera and species". Just because he worded it differently doesn't mean he's saying evolution didn't cause it.

I would also like to cite the rarity of full fossils. The fact that we haven't found fossils of every single modern species of coelacanths does not necessarily mean that coelacanths have changed. It could also mean that we simply have not discovered their fossils.

Agreed. Point?

The part where every phyla shows up abruptly.

Oh, you mean the part I already gave some possible explanations for? (By the way, no, not every phylum developed at that point, just many of them. And there was already evidence of complex multicellular organisms by that time - the Cambrian explosion just resulted in more of them.) Increased oxygen content in the air allowing for growth of larger multicellular organisms and increased coevolution for predator and prey to keep up with each other are two possible explanations, although it's much more likely that there are multiple factors in it. But yes, we know the Cambrian explosion is a phenomenon we have yet to fully explain. We are making advances in understanding it, but ultimately many parts of it escape our knowledge currently. However, the fact that we can't give every factor that led to the explosion right now doesn't do a lot to harm the theory of evolution, considering all the evidence and support we have for it right now.

Um, yeah, there are polystrate fossils near Mt. St. Helen's. But the slides and explosions do not account for all of them.

Oh, look at that, many polystrate fossils which occur from rapid burial due to things like volcanic eruptions are found near a very active volcano. Fancy that. But oh! Rapid burial can't account for all polystrate fossils! Why? ... Because Abundantly said so, I guess.

It all depends on where the trees and mountains were. If the Arbuckle Mountains were near the eruption of the supervolcano, they could have easily been beheaded while the trees on the other side of the world were simply fossilized.

Fair enough. One problem solved...

Ohhh! I get where that supervolcano thing from earlier came from now. You think a supervolcano would have been the catalyst for the Flood. Okay, let's ignore the problem of how that happened and go to that book I mentioned before - Everything is Going to Kill Everybody: The Terrifyingly Real Ways the World Wants You Dead by Robert Brockway (a Cracked writer and freaking hilarious). Oh, yeah, it doesn't sound scientific, but it has references to science journals and essays in it, much like other scientific materials. Anyway, to quote the chapter on supervolcanoes:

A supervolcano occurs when magma builds up below the crust of the Earth, but can't quite break through. All the heat, the gas, and the pressure - it all keeps building up until the Earth just can't take it anymore and bursts. So to sum up: A typical volcanic reaction is like a normal person throwing a fit - a little eruption just to vent the pressure, but generally keeping the devastation to a reasonable level. But sometimes the planet just holds all that fury inside until it snaps. Except by "fury", I mean burning rock, and by "snaps", I mean superexplodes.

There have been only a handful of these supervolcanoes in all of history, but just those few have been responsible for mass extinctions, global weather changes, and sometimes even small ice ages. Supervolcanoes must, at the minimum, consist of at least 1,000 cubic kilometers of magma. That's basically a small country's worth of material, ad it's all lit on fire and flung through the air. The eruption would trigger massive earthquakes, the lava would burn through everything for thousands of miles around, and the ash would choke out the light from the sky. They even keep destroying after they stop: Supervolcanoes don't leave cones like a normal volcano, they create massive calderas more akin to an impact crater, because so much matter is ejected that the Earth simply collapses around it.​

So if we're going to assume a supervolcano caused the flood, we would damn well know that there was a supervolcano happening around 6,000 years ago or whenever you think the flood happened. Massive calderas? Huge earthquakes? At least 1,000 km^3 of molten rock? We'd have at least some evidence of such a massive volcano, and that's not even taking into account the geological evidence for the flood itself. But hey, he said there have been a few supervolcanoes in history. Maybe the most recent one was only 6,000 years ago--

Maybe it can be of some small comfort to you that the last supervolcano was a long, long time ago. Why, over twenty-six thousand years ago as a matter of fact! I can barely remember starting to write this sentence, so twenty-six thousand years is a lot longer than I can even comprehend.​

- Robert Brockway, Everything is Going to Kill Everybody: The Terrifyingly Real Ways the World Wants You Dead, p. 73-74, published 2010

... or not.

1. Y'know, most people appreciate it when someone admits that he was wrong.
2. I never used the irreducible complexity argument.
3. And, uh, yeah, pretty much. I want answers to every question. Why else research?

1. I would too, if you didn't try to use the exact same argument again in the same breath.
2. Oh, I'm sorry, "incipiency". I don't care what you call it, they are exactly the same in their claims. Incipiency claims that various organs and/or systems in organisms are too complicated to have evolved altogether to have evolved together and too interdependent to have evolved separately. Irreducible complexity claims that... various organs and/or systems in organisms are too complicated to have evolved together and too interdependent to have evolved separately. Clearly a huge difference.
3. No no, that's fair enough. I just wonder if you deny that the French Revolution happened because we don't know the names of every single person that died during it.

I know very well that evolutionists believe that the liver formed gradually, but the first response simply said that the liver was made up of cells that formed gradually into the liver (still doesn't answer the question of how the liver survived long enough to do this), and the second response just attacked the creationist.

How was the second guy attacking the creationist? All he did was point out that he was using a logical fallacy, and the assumptions he made in using said fallacy. If you consider that an "attack", there is a problem.

On to the first guy. He started by explaining that all the functions of the liver can be carried out by single-cell organisms, which clearly do not have livers. That in and of itself destroys your claim that the liver had to have evolved all at once in order to function. He then explains the differentiation of cells in multicellular organisms, where cells would have then differentiated to serve a particular purpose in the multicellular organism - one of these cases would have been the differentiation of cells used to carry out functions similar to those of what would eventually become the liver. These would develop further to become more efficient at their job, and eventually cluster together to have a constant supply of blood. Voila! A brief description of the evolution of the liver. Yes, I'm sorry I had trouble coming up with a more detailed description.

And I would like to point out that the fossil had the head still attached.

Oh? Are you sure it was the same species? How are we sure that its head popped off after death? And what makes you think the flood is the only way such a fish could have been buried quickly?

Noah's family. Noah's three sons. Noah's wife. Noah's daughters. All one gene pool. The three wives of Noah's three sons. Three more gene pools. Altogether, there are four. Unless you think that Noah's sons married their own sisters.

Wouldn't Noah's sons' wives' parents (whew) have a gene pool, then? Example: Noah's first daughter-in-law's mother and father. Wouldn't they count as two gene pools, by that logic? Apply this to Noah's other sons, and you have... seven gene pools. Hmm. Even assuming I'm wrong, doesn't that four-gene-pool idea contradict directly with your idea of a Y-chromosomal Adam?

And again, you failed to give a source. You said you did, but I don't see it anywhere. Did I miss it, or are you just ignoring me again?

Now, I don't think I could ever convince you of this, but evolution is a model. And evolutionists take this model as fact. They then look at the evidence and try to fit it to their model. Evolution is the only model that evolutionists fail to recognize as such.

Well, you're sure as hell never going to convince me if all you say is "this is totally what evolutionists do" without providing any reason to believe it. As I said to Super Nerd earlier, evolution is both a fact and a theory. The theory of evolution explains the mechanisms - the "how", so to speak - behind the fact of evolution. Yes, we call evolution a fact. That's because it is. We have seen it happen in the form of the aforementioned nylon-eating bacteria, fruit flies, citric acid-dwelling E. coli, a species of lizard that developed cecal valves when introduced to a new environment, and various types of plants. These are all examples of evolution that we have seen, despite your attempts to redefine the term "evolution" and your opposition to the idea that evolution resulted in the variety of species we see today.

If the mountain is the pencil and the trees are the needles and the water the skin, then I think the trees would cut through the water with more ease than the mountains.

Basic physics fail. Even assuming this is true (and that is not in the least bit true - a flood like that would be more like pushing a needle against a solid steel wall so hard that the needle snaps), a tree would not be rooted as strongly in the ground and would therefore get pulled out of the ground more easily than oh I don't know the top of a huge solid mass of rock.

So. . . Let me get this straight. Evolutionist sources are okay, but creationist sources are not? Both are equally scientific, whether you want to accept it or not. So, what you're telling me is, "That scientist disagrees with me, so whatever he says doesn't count!"

more complaining about a pointless sidenote

First off, no, the Institute for Creation Research (ICR) is not "equally scientific" to TalkOrigins, considering the amount of unscientific crap they've been involved in. And no, I'm not referring to disagreeing with evolution, I'm referring to stuff like "taking quotes out of context to make it look like the quotes' sources disproved/disagreed with evolution", "lying about their own activities", and "making up **** to try and disprove evolution". By the way, that's just what I found on this page. And if you take into account the example of the helium diffusion discussed by "Dr." Humphreys, who was at least partly involved with the Institute for Creation Research, you also get such charges as "mishandling materials in such a way as to corrupt the data obtained from the materials, and using the corrupted data to support YEC" (on the link I just gave, hit Ctrl + F and copy-paste "QUESTIONABLE SAMPLE PROCESSING") and "using faulty data without bothering to check it at all" (search for "A Peer-reviewer of this Essay Uncovers Another Error in a Later Version of Humphreys et al. (2003a)" on the link I gave). Don't try to claim they're equal.

Second, I just said that as an aside. It wasn't even close to my main point that was right above that statement, which you conveniently left out altogether. If it would make you feel better, I could just delete it from my last post altogether, and it wouldn't make a single frickin' difference in my post.

Now, I could easily go through quote everything you say here on out, but it's overwhelmingly clear that regardless of the facts (and interpretation thereof) I may provide for you, you simply will not accept my argument. But I expected as much. Nobody ever wins an internet debate.

That last statement shows you haven't been in many. Yeah, some go on indefinitely or get closed, but some do have clear victors.

And the only reason I "will not accept your argument(s)" is because your arguments are not compelling. Yes, I've had to think on them, but I've found an answer for almost all of them, supported them with sources, and given evidence for everything you've asked. I gave plenty of evidence for endosymbiosis, and yet your only responses to the evidence I provided for it have been, paraphrased, "THAT PROVES NOTHING", "SO THEY LOOK LIKE, ACT LIKE, AND ARE GENETICALLY RELATED TO PROKARYOTES, SO WHAT?", and "YOU'RE ASSUMING IT FITS WITH EVOLUTION, SO IT'S INVALID". You provided an alternative explanation to the evidence exactly once, and that alternative explanation had no citation or evidence to support it.

Here's the thing. I am open to being convinced that the theory of evolution is wrong, or that something other than evolution resulted in the variety of species we see today. This doesn't mean, though, that I will accept everything you say and become a creationist. It means you have to convince me that evolution is wrong and that creationism is the only alternative explanation. The closest you've come to that is pointing out small areas of evolution that we do not yet have a full explanation for, and even then those "holes" don't negate everything else that we do know and have explained about evolution. If I were to conclusively prove that your worldwide flood didn't result from a supervolcano, as you claim, that wouldn't mean all of creationism is wrong, would it? You would probably be pissed if I claimed that was the case. Same sort of thing here.

Prokaryote to Eukaryote -- Not answered sufficiently.
Coelacanths -- Not answered sufficiently.
Cambrian Explosion -- Not answered.
Polystrate Trees -- Not answered.
Incipiency of the Liver -- Not answered.
Missing Links -- Not answered.

- Not fully, no, so I'll give you that... despite you basically ignoring everything I said on that topic anyway.
- How the hell did I not answer your questions on coelacanths? I told you the exact answer to your original question, I told you why that is the answer, and I've basically been repeating myself to get through to you ever since.
- Again, not fully, because we're still researching that area, although, again, you ignored what I did tell you.
- No, I explained it just fine. You just said "but not all of them were caused by that" without bothering to support it, and somehow thought that qualified as a rebuttal.
- Explained further in this post. My earlier posts, as well as every link on this page, deal with the concept of irreducible complexity (oh, I'm sorry, incipiency - tomato, tomahto) as a whole.
- You ignored absolutely every word I said on missing links. "I didn't bother to read it" is not the same as "nobody addressed it".

That last point's the big problem. You have ignored a huge amount of what I have said. This is most obvious in you continuing to claim that evolution requires an increase in information, despite the fact that I have told you that's wrong so many times I literally lost count. Not to mention everything I've said on "missing links" and transitional forms (hint: everything is a transitional form), my discussion of the "dawn horse" (or Hyracotherium) that you brought up, and a massive portion of my second post, which you admitted to not reading much, instead deciding to create a Chrysler Building-sized strawman of my views and arguments. And when you didn't ignore what I said altogether, you gave "alternative explanations" to what I said, acting as if these alternative interpretations made up on the fly without any sort of scientific support were an equal explanation to a well-established, well-supported scientific theory, for no other reason than it may be theoretically possible.

Anyway, with all that said, all that criticism and conflict out on the floor and in the open, I still have to admit, in your own way, you did bring something to the debate. I had to search hard to answer your original questions, and often I had to consult books and websites to come up with answers. In other words, I had to think for this debate, something that doesn't usually happen with a guy like me who's surrounded by fundie creationists (frickin' Alberta). Even if you didn't learn anything from this debate, I did, and I hope others did too.

Later.

... and the post is too long again fffffff